Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

Abstract

Several products such as medicine, food, and cosmetics, especially collagen, can potentially contain pork derivatives, thus a halal analysis is needed. Polymerase Chain Reaction (PCR) is a method that can be used to perform molecular analysis of samples. This study aimed to design a primer candidate for the 12S rRNA pork gene through in silico. The method used was tracing the 12S rRNA gene data through the National Center for Biotechnology Information (NCBI) website, then the 12S rRNA gene sequence was analyzed using the Integrated DNA Technologies (IDT) webserver and MFEprimer-3.1 to select the best primer candidate. The selected primer candidates were then identified using the SnapGene Viewer webserver to observe the ability of the primer candidate to attach to the target sequence. In the last stage, the primer candidate evaluation is carried out using the OligoAnalyzer™ Tool webserver to obtain the best primer candidate pair that meets the good primer criteria. The best primer candidates are forward primer rRNA-5 (5' GTACTACTCGCAACTGCCTAAA 3') and reverse primer rRNA-6 (5'GCAAGGGTTGGTAAGGTCTATC 3') because they meet the ideal primer requirements. Therefore, these primer candidates can be used for in vitro sample characterization using the PCR technique.