DSpace Collection:

Pengembangan Self-Nano Emulsifying System (SNES) Ekstrak Temulawak (Curcuma xanthorrhiza): Formulasi, Karakterisasi, dan Stabilitas

2024-10-30T02:33:38Z

Title: Pengembangan Self-Nano Emulsifying System (SNES) Ekstrak Temulawak (Curcuma xanthorrhiza): Formulasi, Karakterisasi, dan Stabilitas Authors: Fitriani, Hannie; Fitria, Annisa; Annisa, Isnatin; Syukri, Yandi Abstract: The poorly-water soluble temulawak (Curcuma xanthorrhiza) extract has been widely studied and has potential for the treatment of diseases. Self-Nano Emulsifying System (SNES) is a method to increase the solubility of a poorly-water soluble extract by mixing it into a suitable vehicle. This research aimed to prepare, characterize, and test the stability of the SNES Curcuma xanthorrhiza extract. The selection of oil, surfactant, and cosurfactant components for screening of SNES formulation was determined by solubility study of Curcuma xanthorrhiza extract in various vehicles. Curcuma xanthorrhiza extract-loaded SNES was evaluated, including transmittance, particle size, polydisperse index (PI), zeta potential, thermodynamic stability, robustness to dilution, and accelerated stability test. The optimal formula for Curcuma xanthorrhiza extract-loaded-SNES was a combination of Labrasol (20%), Tween 20 (60%), and propyleneglycol (20%), with drug loading of Curcuma xanthorrhiza extract, was 23%. The characterization of Curcuma xanthorrhiza extract-loadedSNES showed that 100.1±0.0% of transmittance; 13.0±1.4 nm of particle size; 0.3±0.1 of PI; and-42.4±0.6 mV of zeta potential. The thermodynamic stability test demonstrated no phase separation. The robustness to the dilution showed that the particle size was stable during the dilution process. Curcuma xanthorrhiza extractloaded SNES was also stable during the accelerated stability test. Conclusion, Curcuma xanthorrhiza extract-loaded-SNES obtained a stable preparation with high drug loading.

In Vitro Cytotoxic Activity Test of Tampa Badak (Voacanga foetida (Blume) Leaves on L1210 Leukemia

2024-10-30T02:25:53Z

Title: In Vitro Cytotoxic Activity Test of Tampa Badak (Voacanga foetida (Blume) Leaves on L1210 Leukemia Authors: Susanty, Adriani; Mora, Enda; Emrizal; Fernando, Armon; Sabari, Ibnu Ranu; Dewi, Ratih kumala Abstract: Based on previous research, the ethanolic extract of the Voacanga foetida (Blume) Rolfe plant has cytotoxic activity using the Brine Shrimps Lethality test. Therefore, further tested the anticancer activity of extracts, fractions and isolated compounds from V. foetida leaves in vitro on L1210 leukemia cells using the direct cell count method with positive control doxorubicin. The results showed that the methanol extract, fraction of butanol fraction, ethyl acetate, and hexane, as well as isolated compounds Tb1 from fraction of hexane, Tb2 from fraction of ethyl acetate, and Tb3 from fraction of butanol leaves from V. foetida, had IC50 values of 4,4; 9; 8,4; 16,8; 0,9; 1,8; and 1,1 µg/mL, while doxorubicin has an IC50 value of 0.2 µg/mL. Based on the IC50 value, it showed that the extract, fraction, and isolated compound from Voacanga foetida leave had a strong cytotoxic effect as evidenced by the IC50 value < 20 µg/mL (extract and fraction) and < 4 µg/mL (isolate) for each test concentration.

Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

2024-10-30T02:20:11Z

Title: Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk Authors: Fakih, Taufik Muhammad; Wijaya, Salsabilla; Priani, Sani Ega Abstract: Several products such as medicine, food, and cosmetics, especially collagen, can potentially contain pork derivatives, thus a halal analysis is needed. Polymerase Chain Reaction (PCR) is a method that can be used to perform molecular analysis of samples. This study aimed to design a primer candidate for the 12S rRNA pork gene through in silico. The method used was tracing the 12S rRNA gene data through the National Center for Biotechnology Information (NCBI) website, then the 12S rRNA gene sequence was analyzed using the Integrated DNA Technologies (IDT) webserver and MFEprimer-3.1 to select the best primer candidate. The selected primer candidates were then identified using the SnapGene Viewer webserver to observe the ability of the primer candidate to attach to the target sequence. In the last stage, the primer candidate evaluation is carried out using the OligoAnalyzer™ Tool webserver to obtain the best primer candidate pair that meets the good primer criteria. The best primer candidates are forward primer rRNA-5 (5' GTACTACTCGCAACTGCCTAAA 3') and reverse primer rRNA-6 (5'GCAAGGGTTGGTAAGGTCTATC 3') because they meet the ideal primer requirements. Therefore, these primer candidates can be used for in vitro sample characterization using the PCR technique.

Profil Penyimpanan Obat Pada Puskesmas di Kota Padang Sumatera Barat

2024-10-30T02:15:03Z

Title: Profil Penyimpanan Obat Pada Puskesmas di Kota Padang Sumatera Barat Authors: Nasif, Hansen; Sari, Yelly Oktavia; Rahmadriza, Zikra Abstract: Drug storage is an important factor in drug management at the Public Health Center, because with proper storage it will be easier and more effective to ensure the quality and quality of drugs. This study aims to obtain a systematic and accurate description of drug storage at the Padang City Public Health Center, West Sumatra Province. This research was conducted at 11 public health centers in 11 districts in the city of Padang. Collecting data through a checklist on aspects of drug storage at the Public Health Center which includes requirements for drug storage warehouses with 11 assessed aspects, drug storage arrangements with 7 assessed aspects and drug preparation procedures with 8 assessed aspects. There are still a number of problems encountered in the field, such as the storage space for drugs that is not up to standard, and the placement of drugs in the warehouse directly on the floor and not on pallets. However, in general, the results of this study indicate that drug storage, drug storage arrangements, and drug preparation procedures in 11 Public Health Center in all districts in the city of Padang are categorized as good with consecutive results of 86.36%; 91.81% and 93.18%.